| Home | E-Submission | Sitemap | Contact Us |  
top_img
Environ Anal Health Toxicol > Volume 39:2024 > Article
Eleyan, Ibrahim, Mohamed, Hussien, Zughbur, Aldalou, Masad, El-Rahman, and Abdelgaid: Quercetin diminishes the apoptotic pathway of magnetite nanoparticles in rats' ovary: Antioxidant status and hormonal profiles

Abstract

Magnetite nanoparticles have attracted the attention of researchers for biomedical uses, but their impacts on the reproductive system did not report. Here, we have studied the possible attenuation efficiency of quercetin against magnetite nanoparticles-induced apoptosis in ovarian. Forty female rats were divided equally into control, quercetin (100 mg/kg), magnetite nanoparticles (50 mg/kg), and magnetite nanoparticles+quercetin, where all rats received their doses for four weeks. Compared with the control, magnetite nanoparticles significantly reduced the serum hormonal levels (follicle-stimulating hormone, luteinizing hormone, estrogen, and progesterone) along with glutathione and superoxide dismutase in ovarian tissues. Moreover, magnetite nanoparticles markedly increased the ovarian malondialdehyde, and apoptotic gene expressions (Bax and caspase-3), and induced many histopathological changes. Significantly, co-treatment with quercetin markedly alleviated the hormonal profile, antioxidant disturbance, and ovarian apoptotic pathway of magnetite nanoparticles. Furthermore, our docking study revealed that quercetin could act as a caspase-3 inhibitor and allosteric agonist to follicle-stimulating hormone (Met520 and Val53), luteinizing hormone (Met517, Ala589, Ser604, and Lys595), estrogen (Met421, Phe425, and Ala350), and progesterone (Met759 and Met909) receptors. Those records reveal that the antioxidants and antiapoptotic characteristics are acceptable pointers for female infertility defenders of quercetin, especially during nanoparticle exposure.

Introduction

Endocrine-related disorders can raise globally through exposure to synthetic chemicals that mimic hormones and disturb the female reproductive system [1]. These chemicals may be found as nano-products in all sectors of life, including medicine, pharmaceuticals, food additives cosmetics, paint self-cleaning glass, pollution treatment [2], and electric devices [3]. Furthermore, nanoparticles can reach the ovaries and disrupt their normal functions by causing follicle damage, irreversible ovarian dysgenesis, or premature ovarian failure [4]. As a result, the possible hazardous effect of nanoparticles on ovaries has received a lot of attention [5]; however, the reproductive toxicity of nanomaterials has received little study [6].
Magnetite nanoparticles, like those naturally occurring on Earth as magnetite (Fe3O4) and maghemite (γ-Fe2O3), have inspired the development of synthetic magnetite nanoparticles )MNPs( for diverse biomedical applications [7]. While their potential benefits are vast, it's crucial to investigate their safety due to the limited knowledge of their cellular and molecular-level toxicity [8].
Recently, the deleterious influence of iron oxide nanoparticles on the development and function of endocrine and reproductive systems depends on their interactions with biological components, cellular absorption, and physicochemical properties [9]. In this respect, iron is one of the most important elements in life, as it is involved in the structure of nearly all of the body's cells. However, iron can accumulate inside the cells and induce oxidative stress via the formation of reactive oxygen species (ROS) and protein aggregation [10]. These ROS can dysregulate folliculogenesis, oocyte maturation, steroid synthesis, and cause tissue damage through lipid peroxidation [11]. This causes mitochondrial malfunction, oxidative phosphorylation in the inner mitochondrial membrane, and apoptosis-related gene overexpression [12].
The usage of flavonoids as an antioxidant against oxidative damage is an important way to maintain reproductive health. Quercetin (QUE) is a flavonoid found in grains, vegetables, and fruits [13]. It has unique antioxidant properties through its ability to scavenge radicals, regulate cellular antioxidant enzymes, chelate transition metals, and inhibit lipid peroxidation [14]. Moreover, QUE has been proposed as a potential therapeutic agent for many pathologies, including viral infection [15], inflammation/allergy [16], hypertension, and atherosclerosis [17]. Furthermore, recent studies have reported that QUE has beneficial effects on ovarian cancer [18] and ovarian oxidative damage [19].
Nowadays, reports about the negative effects of iron oxide nanoparticles are contradictory, and additional research is still needed to assess their possible reproductive toxicity. Moreover, the possible protective efficacy of QUE on MNPs–induced ovarian toxicity is still unknown. Therefore, this study aimed to examine the potential protective effect of QUE against MNPs-induced ovarian toxicity and steroidogenesis disruption in albino rats, with a mechanistic focus on the role of the oxidative stress-mediated upregulation of apoptotic gene expressions.

Materials and Methods

Chemicals used

MNPs (≥ 95 %) were purchased from Nano Gate Company (Egypt). The nanosize of MNPs was confirmed by a high-resolution transmission electron microscope (HR-TEM, Tecnai G20, FEI). Before administration, MNPs were suspended in distilled water and sonicated for 20 minutes. QUE (≥ 95 %) and other analytical grade chemicals were purchased from Sigma Chemical Company (USA).

Animals

Forty female rats (Rattus norvegicus), three months old, weighing 180-200 g were collected from the National Organization for Drug Control & Research (Egypt). The rats were housed in stainless steel cages at a regulated temperature (25 ± 5 °C), with 12:12 hour light-dark cycles. They had unrestricted access to rat stander's feed as well as clean tap water. This protocol (MLS/D/07/21) has been approved by Al Aqsa University in line with the Guidelines on the use and care of laboratory animals.

Experimental design

In this study, rats were screened to estimate the estrous cycle via vaginal smear examination [20], and rats that displayed a normal estrous cycle were used. Rats were divided equally into four groups, where the control group received distilled water (1 ml/kg body weight) and the QUE group received 100 mg/kg body weight of QUE (1 ml/kg body weight) via gavage [21]. The MNPs group intraperitoneally received 50 mg/kg/day of Fe3O4 nanoparticles in 1 ml/kg body weight [22]. The MNPs+QUE group was intubated with the same dose of QUE 2 hours before MNPs intoxication for four weeks. A 28-day exposure spans approximately 6 estrous cycles, capturing various stages of follicle development, ovulation, and corpus luteum formation, allowing for a comprehensive evaluation of potential effects on different ovarian functions.
Animals were anesthetized with sodium pentobarbital (200 mg/kg) after four weeks and blood samples were collected in a serum separator tube. After clotting, it was centrifuged (1000 x g, 15 minutes) to separate the serum, which was aliquoted and stored at -20 °C for hormonal testing. The anterior wall of the abdomen was removed with a transverse incision. The left ovarian tissues were excised, washed, dried, and preserved in neutral-buffered formalin for histological examination. The right ovarian tissues were homogenized in saline (1:10, w/v), centrifuged at 10,000 x g for 15 minutes at 4 °C, and the clear supernatant was removed and used for biochemical parameter testing. The other ovarian tissues were stored at -80 °C for the reverse transcription-polymerase chain reaction (RT-PCR).

Histopathological study

The ovarian tissues were fixed and hydrated in a graded series of ethanol before being cleaned with xylene and embedded in paraffin blocks. Each tissue block was sectioned into 5 µ m thick sections, stained with hematoxylin and eosin [23]. The histomorphological analysis was done by a light microscope (20 sections/animal) and scored by imaging software (ImagePro Plus 5.1, Media Cybernetics, USA).

Assessment of oxidative stress parameters

The malondialdehyde (MDA) level was determined at 534 nm using the method of Satoh [24]. The levels of reduced glutathione (GSH) were determined using the method described by Ellman [25], whereas the enzymatic activity of superoxide dismutase (SOD) was estimated using the method described by Marklund and Marklund [26].

Steroid hormones analysis

The levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), estrogen (ER), and progesterone (PR) in serum were estimated according to the manufacturer's instructions of rat ELISA kits (MyBioSource, Inc., San Diego, USA).

Determination of Bax and caspase-3 by RT-PCR

The RNeasy Mini Kit (catalog no.74104, Qiagen, Germany) was used to extract total RNA. The Revert Aid Reverse Transcriptase (catalog no. K1622, Thermo Fisher) generated the appropriate cDNA. With a total reaction volume of 25 μl (12.5μl 2× SYBR Green PCR Master Mix, 1μl from each primer direction, 2μl cDNA, and 8.5μl of RNase-free water), RT-PCR was done using the Quantitect SYBR Green PCR kit (catalog no. 204141, Qiagen, Germany). The PCR cycles consisted of denaturation at 94 °C for 15 seconds, annealing for 30 seconds at the appropriate annealing temperature corresponding to each specific gene primer (Table 1, Metabion, Germany), and extension at 72 °C for 30 seconds for 40 cycles. To calculate relative expression, the threshold cycle (Stratagene MX3005P software, Agilent Technologies, GmbH) of the examined genes was compared to β-actin [27].

In silico docking analysis

The crystal structure of FSH (8I2G) LH (7FIH), ER (5KRI), and PR (3D90) hormones in complex with their receptors besides caspase-3 (6CKZ) in complex with its inhibitor was downloaded from the protein data bank (PDB) database. The Discovery Studio software (version v21.1.0.20298) was used for protein preparation by removing water, ligands, heteroatoms, duplicate, and unnecessary chains, then polar hydrogen and charges were added. The QUE conformer (CID 5280343) was downloaded from the PubChem database to optimize its geometry by Open Babel [28]. The in silico docking study was done using AutoDock Vina software [29], and obtained conformers were analyzed using Discovery Studio (version v21.1.0.20298). For method validation, all original or co-crystalized ligands were extracted from their corresponding receptors and then re-docked with the same binding pocket of their receptors [30].

Statistical analysis

The IBM SPSS software package (SPSS, version 25, IBM, Chicago, IL, USA) was used for statistical analysis. Data were initially submitted to the exploratory analysis of normality (Shapiro-Wilk test) and homogeneity of variances (Levene's test). The data are presented as the mean ± the standard error of the mean (SEM). A one-way analysis of variance (ANOVA) followed by Turkey's honestly significant difference (HSD) test was used to determine the differences between groups at probability (p) ≤ 0.05.

Results

MNPs HR-TEM analysis

The size of MNPs ranged from 7.92 to 15.90 nm (Figure 1), which enclosed within a homogeneous nanosize range and confirmed the manufacturer's specifications (< 50 nm).

Follicular development

Ovaries from all experimental groups showed all stages of folliculogenesis (Table 2). The number of primordial, primary, secondary, and Graafian follicles did not differ significantly (p > 0.05) between the experimental groups. As compared with control a non-significant (p > 0.05) decrease in primordial, primary, secondary, and Graafian follicles was observed in MNPs (by 13.70, 12.90, 29.27, 21.053 %), MNPs + QUE (by 8.22, 6.45, 24.39, 15.79 %) and also in QUE group (by 4.11, 9.68, 21.95, 10.53 %, respectively).

Follicular development

Ovaries from all experimental groups showed all stages of folliculogenesis (Table 2). The number of primordial, primary, secondary, and Graafian follicles did not differ significantly (p > 0.05) between the experimental groups. As compared with control a non-significant (p > 0.05) decrease in primordial, primary, secondary, and Graafian follicles was observed in MNPs (by 13.70, 12.90, 29.27, 21.053 %), MNPs + QUE (by 8.22, 6.45, 24.39, 15.79 %) and also in QUE group (by 4.11, 9.68, 21.95, 10.53 %, respectively).

Histopathological observations

The ovary from the control (Figure 2A) and QUE (Figure 2B) groups showed normal stroma (S) and developing secondary follicle (SF) with normal histological appearance of granulosa cells, and theca cells. The atretic follicles (AF) with darkly stained nuclei and a secondary follicle (SF) with disordered follicular granulosa cells were noted in MNPs group (Figure 2C). Furthermore, the MNPs+QUE group (Figure 2D) showed a secondary follicle (SF) with good characteristic features surrounded by theca cells and still has some pyknotic nuclei and atretic follicles (AF) was noted.

Hormonal profile

In comparison with the control group; serum FSH (46.04 %), LH (38.8 %), E2 (49.4 %), and PR (41.3 %) levels were significantly reduced (p < 0.05) after the intoxication with MNPs. Remarkably, QUE has normalized the level of LH (p > 0.05) in the combined group, but the FSH (17.03 % p), E2 (33.93 %,), and PR (23.19 %) hormones levels (p < 0.05) did not normalize (Table 3).

Biochemical analysis

Compared with the control, the MDA level in ovarian tissues of the MNPs intoxicated group was significantly elevated (p < 0.05) by 69.54 %, while the levels of SOD (32.9 %) and GSH (29.95 %) were remarkably decreased (p < 0.05). Compared with the MNPs group, the levels of MDA (by 19.54 %, p > 0.05), SOD (by 3.68 % p > 0.05), and GSH (by 17.05 % p < 0.05) were markedly alleviated in the MNPs + QUE group. Moreover, the level of MDA and SOD activity reached the control value after QUE co-treatment, but GSH did not return to this value (Table 4).
Each value represented the means ± SEM. Tukey's honestly significant difference (p ≤0.05) test was applied after a oneway analysis of variance (ANOVA). The differences between the groups within the same row were represented by means with different letters.

Relative quantity of Bax and caspase-3

Bax and caspase-3 gene expression in the ovarian tissues of MNPs were significantly (p < 0.05) increased by 7.2- fold and 11.7-fold, respectively as compared with the control level (Figure 3). In the MNPs+QUE group, the expression of Bax (3.49-fold) and caspase-3 (8.23-fold) genes were significantly (p˂0.05) downregulated, however; QUE could not recover the gene expression of Bax and caspase-3 to the normal expression (Figure 3).

Docking analysis

Method validation

The root means square deviation (RMSD) between the docked and experimental co-crystalized ligands revealed that the first poses of the docked co-crystalized ligands nearly superimposes (RMSD < 1) with the experimental ones (Figure 4). Thus, the docking method was reasonably accurate and reproducible.

Docking simulation of QUE with caspase-3 binding pocket (6CKZ)

As shown in Figure (5), QUE docked inside a 6CKZ binding pocket where the interaction occurred at binding energy of -7.2 kcal/mol (Figure 5A) where five conventional hydrogen bonds formed with Gly122, His121, Ser120, Gln161, and Arg207 with bond length 2.37, 1.85, 2.32, 2.21, and 3.09Å, respectively (Figure 5B). Moreover, QUE formed a hydrophobic interaction with Arg207 residue inside the caspase-3 enzyme active site. Other observed interaction involving Pi-donor hydrogen bonds and Pi-Sulfur interaction with Cys163, Pi-donor hydrogen with His121, and Pi-Cation interactions with Arg207 besides van der Waals interaction with Ala162, Glu123, Ser205, and Trp206 (Figure 5B).

Docking simulation of QUE with FSH receptor (8I2G)

QUE docked inside the 8I2G binding pocket where the interaction occurred at a binding energy of -8.7 kcal/mol with three conventional hydrogen bonds formed with Pro519, Ala607, and Ile588 with bond lengths 2.24, 2.60, and 2.26 Å, respectively. Moreover, QUE formed good hydrophobic interactions through its carbon-hydrogen skeleton with Met520, Ala595, Ala592, Ala607, and Ile588 residues inside the receptor binding pocket. Furthermore, QUE becomes close to Phe353, Ile522, Ser596, Val531, L518, Leu610, Pro587, Phe591, and Ile602 across van der Waals interaction (Figure 6B) besides close vicinity of His615 (Figure 6A).

Docking simulation of QUE with LH receptor (7FIH)

The 7FIH-QUE complex formed at binding free energy of -8.4 kcal/mol (Figure 7. A) where QUE formed three hydrogen bonds inside the binding pocket of 7FIH protein receptor through its hydroxyl groups as hydrogen bond donor with oxygens of Glu451 (2.55 Å) and Val447 (2.98 Å), and through its oxygen as hydrogen bond acceptor with Ser450 (2.80 Å). Regarding the hydrophobic interactions, it was formed with Ala589, Met517 134, Pro516, and Val447 amino acid residues inside the receptor active site. Van der Waals interactions formed with Ala592, Leu532, Ile528, Asn535, Ile531, Thr446, Tyr612, Ile585, Leu608, and Ser604 (Figure 7B) besides close vicinity of Lys595 (Figure 7A).

Docking simulation of QUE with ER receptor (5KRI)

QUE docked inside the 5KRI binding pocket where the interaction occurred at a binding energy of -8.3 kcal/mol (Figure 8A) and two conventional hydrogen bonds formed with Arg394 and Glu353 with bond lengths 1.92 and 2.02Å, respectively. Moreover, QUE formed good hydrophobic interactions through its carbon-hydrogen skeleton with Ile424, Met421, Pro404, Leu391, Ala350, and Leu387 residues inside the receptor binding pocket. Moreover, QUE becomes close to Phe425, Leu428, Met388, Leu349, Leu384, Leu525, His524, and Gly521 across van der Waals interaction (Figure 8B).

Docking simulation of QUE with PR receptor (3D90)

The 3D90-QUE complex formed at binding free energy of -9.2 kcal/mol (Figure 9A) where three conventional hydrogen bonds formed with Met759, Gln725, and Leu718 with bond lengths 2.12, 2.24, and 2.94Å, respectively (Figure 9B). Moreover, QUE formed hydrophobic interaction with Phe778 and Leu718 residues inside the PR active site. Other observed interaction involving Pi-Sulfur interaction with Met759 besides close vicinity to Leu763, Val760, Leu797, Phe794, Tyr890, Leu715, Cys891, Phe905, Asn719, Gly722, Trp755, Leu721, and Arg766 (Figure 9B).

Discussion

Recently, there has been an increased concern about the toxicity of nanoparticles as they can pass the bloodstream to deposit on tissues and cause adverse events [31]. In this respect, MNPs may accumulate in the ovaries and induce structural and functional changes, however; their adverse mechanistic effects on reproductive performance are still unknown. Therefore, the current work evaluated the potential protective roles of QUE against the toxic effects of MNPs on rats' ovaries, with a mechanistic focus on hormone dysregulation, oxidative damage, and apoptosis.
The growing follicles are extremely sensitive to hazardous substances, these negative consequences could arise once MNPs cross the blood-follicle barrier to enter the ovary via the bloodstream [32]. Former investigations have found that metal-based nanoparticles produce deformities in the histology of laboratory animals' reproductive organs, causing a distraction in reproductive cell synthesis [33,34]. Moreover, nanoparticles can arrive at the ovaries via the circulatory system and aggregate in granulosa and theca cells, causing ovum dysplasia, as well as disrupting their normal function, especially their key role in hormone production [35]. Therefore, the serum FSH, LH, E2, and PR levels were lowered following MNPs intoxication. Our data suggested that MNPs may interfere with the function of antral follicles by causing genotoxicity [34] and/or changing the activity of enzymes that produce E2 and steroid hormones [36]. Similarly, steroidogenic enzymes in the corpora luteal may be disrupted, resulting in insufficient PR and E2 levels [37]. Moreover, the hypothalamus-pituitary–ovarian axis may be disturbed by a lack of ovarian-derived steroid hormones, resulting in LH and FSH suppression [38].
Recently, FSH and LH enhance ovarian activity via binding with G-protein-coupled receptors on the surface of target cells, granulosa cells, where the binding specificity is governed by critical interaction sites involving both common and hormone-specific subunits [39]. Those hormones undergo a coordinated conformational change upon binding, which changes bulging loops in their receptor [40]. Therefore, this specific binding can be interrupted by interacting with MNPs that may interfere with the normal folding and conformations of proteins, especially those nanoparticles that have highly toxic properties as they can move deep inside the cells and elicit a purge of ROS [41].
Our results have confirmed the oxidative injury induced by MNPs by increasing the level of MDA and declining the content of GSH besides SOD activity in the ovarian tissues. These findings suggested that the variability of the oxidantantioxidant system could be a key mechanism by which MNPs promote cellular damage. This could be attributable to the liberation of free iron from uncoated particles inside the tissue, which can produce ROS [42] to interact with biological components and increase the level of MDA as a subsequent result [43]. Moreover, MDA level is adversely associated with LH concentrations as an increase in oxidative stress can distribute LH levels, which promotes pathophysiology in female infertility, principally via fluctuations in the gonadotrophin hormones [34]. Furthermore, the declined GSH content may result from its free radical scavenging properties to protect ovarian cells from MNPs-induced oxidative stress [44]. As a result, the depletion of GSH concentration, which is maintained intracellularly through the dependent action of its related enzymes, leads to an antioxidant enzyme activity reserve [45]. Therefore, the decreased SOD activity in ovarian tissue could be due to an excess of oxy-radical resulting from MNPs poisoning [43], which is immediately transformed to H2O2 by SOD activity and subsequently eliminated as water by catalase enzyme [46].
Our findings proposed that MNPs could stimulate ROS production, which disrupts the redox status and initiates the mitochondrial route of apoptosis via upregulation of the Bax and caspase-3 gene expression in ovarian tissues [47]. This pathway is primarily regulated by the Bcl-2 family of proteins and activated via ROS production [48]. In this pathway, excessive ROS may distribute the mitochondrial outer membrane which initiates the interaction between an activated Bax with other Bcl-2 and causes apoptosis by releasing cytochrome-c from mitochondria to the cytoplasm [49]. The cytoplasmic cytochrome-c can activate caspase-9, which stimulates the effector caspase-3 [50] to initiate an apoptotic signaling cascade and produce DNA damage [51]. Our study suggested that MNPs might slightly interact with necessary transcription factor sequences on Bax and caspase-3 genes. This close adherence with the ability for ROS production at these sites may become a message for the activation of redox-sensitive transcription factors [52], that can positively regulate these apoptotic enhancer genes and increase their expression levels.
Remarkably, co-treatment with QUE revealed beneficial improvements in the levels of females' fertility hormones and ovarian histology. These improvements may result from the phytoestrogenic activity of QUE which regulates the binding of E2 with E2-α and β receptors, resulting in enhancements of ovarian folliculogenesis by increasing the number of healthful follicles and hormone production [53]. This hypothesis has been confirmed by Amevor et al [54], who reported that QUE could regulate the secretion and concentration of reproductive hormones and their receptors, particularly E2. It's also thought that QUE can control the specific regulatory enzymes that switch steroid hormone creation and metabolism [55], like FSH, LH, E2, and PR. Therefore, QUE can ameliorate the infertility action of MNPs by regulating reproductive system functions such as folliculogenesis, and oocyte maturation, and it may be useful in the treatment of reproductive disorders such as endometriosis, and hormonal disorders [56].
Our in silico study showed that QUE interacted with amino acid residues such as Met520 and Val53 that can activate FSH receptors. This interaction gives a medium activity to the receptor and may protect this residue from oxidation by ROS [57]. Correspondingly, QUE could interact with the main residues responsible for the activation of the LH receptor as Met517, Ala589, Ser604, and Lys595 [39] as well as the main residues responsible for the activation of the E2 receptor as Met421, Phe425, and Ala350 [58]. Also, PR can be activated by QUE by interacting with Met759 and close to Met909 via the allosteric agonist [59].
We also observed that QUE can reduce ovarian oxidative injury in the MNPs-intoxicated rats by decreasing MDA levels and increasing GSH content as well as the enzymatic activity of SOD. These improvements may be related to the scavenging activity of QUE and metal-chelating abilities that hinder ROS-caused oxidative destruction and hormonal disturbances [53]. This scavenging characteristic has resulted from the catechol and hydroxyl groups [22] that may give QUE the ability to decrease ROS production and hinder lipid peroxidation by reducing the level of MDA and enhancing the biosynthesis of GSH. Furthermore, QUE could lower oxidative stress via transcriptional activation of nuclear factor erythroid 2–related factor 2 (Nrf2), which control many antioxidant genes, including catalase, SOD, glutathione peroxidase 2, heme-oxygenase-1 (HO-1), and thioredoxin [60].
Subsequently, the regulation of cellular antioxidant hemostasis by QUE could prevent oxidative injuries and histopathological alterations that hinder the release of cytochrome c from mitochondria by decreasing the expression of apoptosis-related genes (Bax and caspase-3). Another possible anti-apoptotic efficacy of QUE is increasing the expression of the anti-apoptotic protein (Bcl-2), which downregulates the expression of apoptosis-related genes (Bax and caspase-3) and prevents the apoptosis cascade [54]. Moreover, the activation of sirtuins by QUE may prevent Bax-dependent apoptosis and eliminate many pro-apoptotic transcription factors [61]. Remarkably, our docking study showed that QUE could interact as an inhibitor at a high affinity with the binding pocket of caspase-3, especially with His121 and Cys163, which are the main residues of the enzyme catalytic activity [62] as mentioned on the UniProt database (P42574).

Conclusions

Our data represent the amelioration efficiency of QUE in the MNPs-impaired female reproductive system, oxidative injury, and mitochondrial apoptotic pathway. These efforts may be elicited by improving the endogenous antioxidant status followed by reducing ovarian apoptosis to restore hormonal homeostasis. Based on our findings, women should avoid exposure to nanoparticles due to their toxic effects on the reproductive system. Moreover, further research is needed to confirm the possible signaling pathway that would explain the effects of QUE on the endocrine system that regulates folliculogenesis.

Notes

No potential conflict of interest was reported by the authors.
Funding
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
Data availability
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
CRediT author statement
ME: Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; KAI: Conceptualization, Project administration, Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization, Writing-Review & Editing; RAM: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; MH: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; MRZ: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; ARA: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; AM: Resources, Data curation, Formal analysis, Software, Investigation, Validation, Visualization; HAAER: Resources, Methodology, Data curation, Software, Investigation, Validation, Visualization; HAA: Resources, Methodology, Data curation, Formal analysis, Software, Investigation, Validation, Visualization, Writing–Original draft.

References

1. Soygur B, Laird DJ. Ovary development: Insights from a three-dimensional imaging revolution. Front Cell Dev Biol 2021;9: 698315 https://doi.org/10.3389/fcell.2021.698315.
crossref pmid pmc
2. Khwanes SA, Mohamed RA, Ibrahim KA, Abd El-Rahman HA. Ginger reserves testicular spermatogenesis and steroidogenesis in difenoconazole-intoxicated rats by conducting oxidative stress, apoptosis and proliferation. Andrologia 2022;54(1):e14241. https://doi.org/10.1111/and.14241.
crossref pmid
3. Yang J, Hu S, Rao M, Hu L, Lei H, Wu Y, et al. Copper nanoparticle-induced ovarian injury, follicular atresia, apoptosis, and gene expression alterations in female rats. Int J Nanomedicine 2017;12: 5959-5971 https://doi.org/10.2147/IJN.S139215.
crossref pmid pmc
4. Hong F, Wang L. Nanosized titanium dioxide-induced premature ovarian failure is associated with abnormalities in serum parameters in female mice. Int J Nanomedicine 2018;13: 2543-2549 https://doi.org/10.2147/IJN.S151215.
crossref pmid pmc
5. Chi PW, Paul T, Su YH, Su KH, Su CY, Wu PM, et al. A study on Ti-doped Fe3O4 anode for Li ion battery using machine learning, electrochemical and distribution function of relaxation times (DFRTs) analyses. Sci Rep 2022;12(1):4851 https://doi.org/10.1038/s41598-022-08584-4.
crossref pmid pmc
6. Ajdary M, Keyhanfar F, Moosavi MA, Shabani R, Mehdizadeh M, Varma RS. Potential toxicity of nanoparticles on the reproductive system animal models: A review. J Reprod Immunol 2021;148: 103384 https://doi.org/10.1016/j.jri.2021.103384.
crossref pmid
7. Ansari MO, Parveen N, Ahmad MF, Wani AL, Afrin S, Rahman Y, et al. Evaluation of DNA interaction, genotoxicity and oxidative stress induced by iron oxide nanoparticles both in vitro and in vivo: attenuation by thymoquinone. Sci Rep 2019;9: 6912 https://doi.org/10.1038/s41598-019-43188-5.
crossref pmid pmc
8. Ahamed M, Akhtar MJ, Khan MAM. Investigation of cytotoxicity, apoptosis, and oxidative stress response of Fe3O4-RGO nanocomposites in human liver HepG2 cells. Materials (Basel) 2020;13(3):660 https://doi.org/10.3390/ma13030660.
crossref pmid pmc
9. Vakili-Ghartavol R, Momtazi-Borojeni AA, Vakili-Ghartavol Z, Aiyelabegan HT, Jaafari MR, Rezayat SM, et al. Toxicity assessment of superparamagnetic iron oxide nanoparticles in different tissues. Artif Cells Nanomed Biotechnol 2020;48(1):443-451 https://doi.org/10.1080/21691401.2019.1709855.
crossref pmid
10. Galaris D, Barbouti A, Pantopoulos K. Iron homeostasis and oxidative stress: An intimate relationship. Biochim Biophys Acta Mol Cell Res 2019;1866(12):118535 https://doi.org/10.1016/j.bbamcr.2019.118535.
crossref pmid
11. Lin J, Wang L. Oxidative stress in oocytes and embryo development: Implications for in vitro systems. Antioxid Redox Signal 2021;34(17):https://doi.org/10.1089/ars.2020.8209.
crossref pmid
12. Lim W, Ryu S, Bazer FW, Kim SM, Song G. Chrysin attenuates progression of ovarian cancer cells by regulating signaling cascades and mitochondrial dysfunction. J Cell Physiol 2018;233(4):3129-3140 https://doi.org/10.1002/jcp.26150.
crossref pmid
13. Erlund I, Freese R, Marniemi J, Hakala P, Alfthan G. Bioavailability of quercetin from berries and the diet. Nutr Cancer 2006;54(1):13-17 https://doi.org/10.1207/s15327914nc5401_3.
crossref pmid
14. Ibrahim KA, Eleyan M, Khwanes SA, Mohamed RA, Abd El-Rahman HAA. Quercetin ameliorates the hepatic apoptosis of foetal rats induced by in utero exposure to fenitrothion via the transcriptional regulation of paraoxonase-1 and apoptosis-related genes. Biomarkers 2021;26(2):152-162 https://doi.org/10.1080/1354750X.2021.1875505.
crossref pmid
15. Wu W, Li R, Li X, He J, Jiang S, Liu S, et al. Quercetin as an antiviral agent inhibits influenza A virus (IAV) entry. Viruses 2015;8(1):6 https://doi.org/10.3390/v8010006.
crossref pmid pmc
16. Sato S, Mukai Y. Modulation of chronic inflammation by quercetin: The beneficial effects on obesity. J Inflamm Res 2020;13: 421-431 https://doi.org/10.2147/JIR.S228361.
crossref pmid pmc
17. Cao H, Jia Q, Shen D, Yan L, Chen C, Xing S. Quercetin has a protective effect on atherosclerosis via enhancement of autophagy in ApoE-/- mice. Exp Ther Med 2019;18(4):2451-2458 https://doi.org/10.3892/etm.2019.7851.
crossref pmid pmc
18. Shafabakhsh R, Asemi Z. Quercetin: a natural compound for ovarian cancer treatment. J Ovarian Res 2019;12: 55 https://doi.org/10.1186/s13048-019-0530-4.
crossref pmid pmc
19. Wang J, Qian X, Gao Q, Lv C, Xu J, Jin H, et al. Quercetin increases the antioxidant capacity of the ovary in menopausal rats and in ovarian granulosa cell culture in vitro. J Ovarian Res 2018;11(1):51 https://doi.org/10.1186/s13048-018-0421-0.
crossref pmid pmc
20. Marcondes FK, Bianchi FJ, Tanno AP. Determination of the estrous cycle phases of rats: some helpful considerations. Braz J Biol 2002;62(4A):609-614 https://doi.org/10.1590/s1519-69842002000400008.
crossref pmid
21. Sistani Karampour N, Arzi A, Najafzadeh Varzi H, Mohammadian B, Rezaei M. Quercetin preventive effects on theophylline-induced anomalies in rat embryo. Jundishapur J Nat Pharm Prod 2014;9(3):e17834. https://doi.org/10.17795/jjnpp-17834.
crossref pmid pmc
22. Dora MF, Taha NM, Lebda MA, Hashem AE, Elfeky MS, El-Sayed YS, et al. Quercetin attenuates brain oxidative alterations induced by iron oxide nanoparticles in rats. Int J Mol Sci 2021;22(8):3829 https://doi.org/10.3390/ijms22083829.
crossref pmid pmc
23. Pasyk KA, Hassett CA. Modified hematoxylin and eosin staining method for epoxy-embedded tissue sections. Pathol Res Pract 1989;184(6):635-638 https://doi.org/10.1016/S0344-0338(89)80170-0.
crossref pmid
24. Satoh K. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin Chim Acta 1978;90(1):37-43 https://doi.org/10.1016/0009-8981(78)90081-5.
crossref pmid
25. Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys 1959;82(1):70-77 https://doi.org/10.1016/0003-9861(59)90090-6.
crossref pmid
26. Marklund S, Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 1974;47(3):469-474 https://doi.org/10.1111/j.1432-1033.1974.tb03714.x.
crossref pmid
27. Yuan JS, Reed A, Chen F, Stewart Jr. CN. Statistical analysis of real-time PCR data. BMC Bioinformatics 2006;7: 85 https://doi.org/10.1186/1471-2105-7-85.
crossref pmid pmc
28. O’Boyle NM, Banck M, James CA, Morley C, Vandermeersch T, Hutchison GR. Open babel: An open chemical toolbox. J Cheminform 2011;3: 33 https://doi.org/10.1186/1758-2946-3-33.
crossref pmid pmc
29. Trott O, Olson AJ. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 2010;31(2):455-461 https://doi.org/10.1002/jcc.21334.
crossref pmid pmc
30. Nafie MS, Tantawy MA, Elmgeed GA. Screening of different drug design tools to predict the mode of action of steroidal derivatives as anti-cancer agents. Steroids 2019;152: 108485 https://doi.org/10.1016/j.steroids.2019.108485.
crossref pmid
31. Ibrahim KA, Abdelgaid HA, Eleyan M, Mohamed RA, Gamil NM. Resveratrol alleviates cardiac apoptosis following exposure to fenitrothion by modulating the sirtuin1/c-Jun N-terminal kinases/p53 pathway through pro-oxidant and inflammatory response improvements: In vivo and in silico studies. Life Sci 2022;290: 120265 https://doi.org/10.1016/j.lfs.2021.120265.
crossref pmid
32. Feng Q, Liu Y, Huang J, Chen K, Huang J, Xiao K. Uptake, distribution, clearance, and toxicity of iron oxide nanoparticles with different sizes and coatings. Scientific Reports 2018;8: 2082 https://doi.org/10.1038/s41598-018-19628-z.
crossref pmid pmc
33. Kolesarova A, Capcarova M, Sirotkin A, Medvedova M, Kovacik J. Cobalt-induced changes in the IGF-I and progesterone release, expression of proliferation- and apoptosis-related peptides in porcine ovarian granulosa cells in vitro. J Environ Sci Health A Tox Hazard Subst Environ Eng 2010;45(7):810-817 https://doi.org/10.1080/10934521003708968.
crossref pmid
34. Ibraheem SR, Ibrahim MR. Physiological and histological effects of (zinc and iron) oxide nanoparticles on some fertility parameters in female mice. Al-Mustansiriyah Journal of Science 2016;27(5):1-10 https://doi.org/10.23851/mjs.v27i5.160.
crossref
35. Hou CC, Zhu JQ. Nanoparticles and female reproductive system: how do nanoparticles affect oogenesis and embryonic development. Oncotarget 2017;8(65):109799-109817 https://doi.org/10.18632/oncotarget.19087.
crossref pmid pmc
36. Iavicoli I, Fontana L, Leso V, Bergamaschi A. The effects of nanomaterials as endocrine disruptors. Int J Mol Sci 2013;14(8):16732-16801 https://doi.org/10.3390/ijms140816732.
crossref pmid pmc
37. Craig ZR, Wang W, Flaws JA. Endocrine-disrupting chemicals in ovarian function: effects on steroidogenesis, metabolism and nuclear receptor signaling. Reproduction 2011;142(5):633-646 https://doi.org/10.1530/REP-11-0136.
crossref pmid
38. Bhattacharya P, Keating AF. Impact of environmental exposures on ovarian function and role of xenobiotic metabolism during ovotoxicity. Toxicol Appl Pharmacol 2012;261(3):227-235 https://doi.org/10.1016/j.taap.2012.04.009.
crossref pmid pmc
39. Duan J, Xu P, Cheng X, Mao C, Croll T, He X, et al. Structures of full-length glycoprotein hormone receptor signalling complexes. Nature 2021;598(7882):688-692 https://doi.org/10.1038/s41586-021-03924-2.
crossref pmid
40. Puett D, Angelova K, da Costa MR, Warrenfeltz SW, Fanelli F. The luteinizing hormone receptor: insights into structurefunction relationships and hormone-receptor-mediated changes in gene expression in ovarian cancer cells. Mol Cell Endocrinol 2010;329(1-2):47-55 https://doi.org/10.1016/j.mce.2010.04.025.
crossref pmid pmc
41. Passagne I, Morille M, Rousset M, Pujalté I, L’azou B. Implication of oxidative stress in size-dependent toxicity of silica nanoparticles in kidney cells. Toxicology 2012;299(2-3):112-124 https://doi.org/10.1016/j.tox.2012.05.010.
crossref pmid
42. Angelova PR, Esteras N, Abramov AY. Mitochondria and lipid peroxidation in the mechanism of neurodegeneration: Finding ways for prevention. Med Res Rev 2021;41(2):770-784 https://doi.org/10.1002/med.21712.
crossref pmid
43. Gaschler MM, Stockwell BR. Lipid peroxidation in cell death. Biochem Biophys Res Commun 2017;482(3):419-425 https://doi.org/10.1016/j.bbrc.2016.10.086.
crossref pmid pmc
44. Radu M, Dinu D, Sima C, Burlacu R, Hermenean A, Ardelean A, et al. Magnetite nanoparticles induced adaptive mechanisms counteract cell death in human pulmonary fibroblasts. Toxicol In Vitro 2015;29(7):1492-1502 https://doi.org/10.1016/j.tiv.2015.06.002.
crossref pmid
45. Ibrahim KA, Eleyan M, El-Rahman HAA, Khwanes SA, Mohamed RA. Quercetin attenuates the oxidative injurymediated upregulation of apoptotic gene expression and catecholaminergic neurotransmitters of the fetal rats’ brain following prenatal exposure to fenitrothion insecticide. Neurotox Res 2020;37(4):871-882 https://doi.org/10.1007/s12640-020-00172-6.
crossref pmid
46. Hassani S, Maqbool F, Salek-Maghsoudi A, Rahmani S, Shadboorestan A, Nili-Ahmadabadi A, et al. Alteration of hepatocellular antioxidant gene expression pattern and biomarkers of oxidative damage in diazinon-induced acute toxicity in Wistar rat: A time-course mechanistic study. EXCLI J 2018;17: 57-71 https://doi.org/10.17179/excli2017-760.
crossref pmid pmc
47. Ibrahim KA, Abdelgaid HA, El-Desouky MA, Fahmi AA, Abdel-Daim MM. Modulation of paraoxonase-1 and apoptotic gene expression involves in the cardioprotective role of flaxseed following gestational exposure to diesel exhaust particles and/or fenitrothion insecticide. Cardiovasc Toxicol 2020;20(6):604-617 https://doi.org/10.1007/s12012-020-09585-3.
crossref pmid
48. Quast SA, Berger A, Eberle J. ROS-dependent phosphorylation of Bax by wortmannin sensitizes melanoma cells for TRAIL-induced apoptosis. Cell Death Dis 2013;4(10):e839. https://doi.org/10.1038/cddis.2013.344.
crossref pmid pmc
49. Chipuk JE, Green DR. How do BCL-2 proteins induce mitochondrial outer membrane permeabilization? Trends Cell Biol 2008;18(4):157-164 https://doi.org/10.1016/j.tcb.2008.01.007.
crossref pmid pmc
50. Bratton SB, Walker G, Srinivasula SM, Sun XM, Butterworth M, Alnemri ES, et al. Recruitment, activation and retention of caspases-9 and -3 by Apaf-1 apoptosome and associated XIAP complexes. EMBO J 2001;20(5):998-1009 https://doi.org/10.1093/emboj/20.5.998.
crossref pmid pmc
51. Alam RT, Imam TS, Abo-Elmaaty AMA, Arisha AH. Amelioration of fenitrothion induced oxidative DNA damage and inactivation of caspase-3 in the brain and spleen tissues of male rats by N-acetylcysteine. Life Sci 2019;231: 116534 https://doi.org/10.1016/j.lfs.2019.06.009.
crossref pmid
52. Rim KT, Song SW, Kim HY. Oxidative DNA damage from nanoparticle exposure and its application to workers' health: a literature review. Saf Health Work 2013;4(4):177-186 https://doi.org/10.1016/j.shaw.2013.07.006.
crossref pmid pmc
53. Rashidi Z, Khosravizadeh Z, Talebi A, Khodamoradi K, Ebrahimi R, Amidi F. Overview of biological effects of quercetin on ovary. Phytother Res 2021;35(1):33-49 https://doi.org/10.1002/ptr.6750.
crossref pmid
54. Amevor FK, Cui Z, Du X, Ning Z, Shu G, Jin N, et al. Combination of quercetin and vitamin E supplementation promotes yolk precursor synthesis and follicle development in aging breeder hens via liver-blood-ovary signal axis. Animals (Basel) 2021;11(7):1915 https://doi.org/10.3390/ani11071915.
crossref pmid pmc
55. Sirotkin AV, Štochmaľová A, Grossmann R, Alwasel S, Harrath AH. Quercetin directly promotes rabbit ovarian steroidogenesis. World Rabbit Sciecne 2019;27(3):163-167 https://doi.org/10.4995/wrs.2019.11816.
crossref
56. Xiao L, Luo G, Tang Y, Yao P. Quercetin and iron metabolism: What we know and what we need to know. Food Chem Toxicol 2018;114: 190-203 https://doi.org/10.1016/j.fct.2018.02.022.
crossref pmid
57. Duan J, Xu P, Zhang H, Luan X, Yang J, He X, et al. Mechanism of hormone and allosteric agonist mediated activation of follicle stimulating hormone receptor. Nat Commun 2023;14(1):519 https://doi.org/10.1038/s41467-023-36170-3.
crossref pmid pmc
58. Nwachukwu JC, Srinivasan S, Bruno NE, Nowak J, Wright NJ, Minutolo F, et al. Systems structural biology analysis of ligand effects on ERα predicts cellular response to environmental estrogens and anti-hormone therapies. Cell Chem Biol 2017;24(1):35-45 https://doi.org/10.1016/j.chembiol.2016.11.014.
crossref pmid
59. Petit-Topin I, Turque N, Fagart J, Fay M, Ulmann A, Gainer E, et al. Met909 plays a key role in the activation of the progesterone receptor and also in the high potency of 13-ethyl progestins. Mol Pharmacol 2009;75(6):1317-1324 https://doi.org/10.1124/mol.108.054312.
crossref pmid
60. Dong Y, Lei J, Zhang B. Effects of dietary quercetin on the antioxidative status and cecal microbiota in broiler chickens fed with oxidized oil. Poult Sci 2020;99(10):4892-4903 https://doi.org/10.1016/j.psj.2020.06.028.
crossref pmid pmc
61. Costa LG, Garrick JM, Roquè PJ, Pellacani C. Mechanisms of neuroprotection by quercetin: Counteracting oxidative stress and more. Oxid Med Cell Longev 2016;2016: 2986796 https://doi.org/10.1155/2016/2986796.
crossref pmid pmc
62. Solania A, González-Páez GE, Wolan DW. Selective and rapid cell-permeable inhibitor of human caspase-3. ACS Chem Biol 2019;14(11):2463-2470 https://doi.org/10.1021/acschembio.9b00564.
crossref pmid pmc

Figure 1.
HRTEM images of MNPs. Scale bar: 100 μm.
eaht-39-3-e2024025f1.jpg
Figure 2.
Histopathological photomicrographs of H&E-stained ovarian tissue sections. Control group (A) and QUE group (B) exhibited normal stroma (S) and developing secondary follicle (SF) with normal histological appearance of granulosa cells (star), and theca cells (black arrow). The atretic follicles (AF) with darkly stained nuclei (yellow arrow) and a secondary follicle (SF) with disordered follicular granulosa cells (green arrow) were noted in MNPs group (C) The MNPs + QUE group (D) showed a secondary follicle (SF) with the good characteristic features of an oocyte (short arrow), zona pellucida (star), corona radiata (arrowhead), and granulosa cells (G) surrounded by theca cells (black arrow). Scale bar: 150 μm..
eaht-39-3-e2024025f2.jpg
Figure 3.
The protective effect of QUE against MNPs-induced upregulation in the ovarian level of Bax and caspase-3 mRNA. Each value represented the means ± SEM. Tukey's honestly significant difference (p ≤ 0.05) test was applied after a one-way analysis of variance (ANOVA). The differences between the groups within the same column were represented using different letters.
eaht-39-3-e2024025f3.jpg
Figure 4.
Superposition of the output docked ligand (sky blue) and the co-crystallized ligand (buff) of 6CKZ (A), 8I2G (B), 7FIH (C), 5KRI (D), and 3D90 (E) at the first pose (RMSD=0).
eaht-39-3-e2024025f4.jpg
Figure 5.
Binding disposition and ligand-receptor interactions of QUE inside Caspase3 (6CKZ) binding site A: 3D conformer B: 2D conformer.
eaht-39-3-e2024025f5.jpg
Figure 6.
Binding disposition and ligand-receptor interactions of QUE inside FSH receptor (8I2G) binding site A: 3D conformer B: 2D conformer.
eaht-39-3-e2024025f6.jpg
Figure 7.
Binding disposition and ligand-receptor interactions of QUE inside LH receptor (7FIH) binding site A: 3D conformer B: 2D conformer.
eaht-39-3-e2024025f7.jpg
Figure 8.
Binding disposition and ligand-receptor interactions of QUE inside ER receptor (5KRI) binding site A: Hydrogen bonds B: Hydrophobicity.
eaht-39-3-e2024025f8.jpg
Figure 9.
Binding disposition and ligand-receptor interactions of QUE inside PR receptor (3D90) binding site A: Hydrogen bonding B: Hydrophobicity.
eaht-39-3-e2024025f9.jpg
Table 1.
Oligonucleotide primers used in RT-PCR.
Gene Primer Sequence (5'-3') Product Length Accession Number Annealing Temp. (℃)
Bax F- CACCAGCTCTGAACAGATCATGA 541 NM_017059.2 60
R- TCAGCCCATCTTCTTCCAGATGGT
Caspase-3 F- AGTTGGACCCACCTTGTGAG 298 XM_006253130.4 59
R- AGTCTGCAGCTCCTCCACAT
ß-actin F- TCCTCCTGAGCGCAAGTACTCT 153 NM_031144.3 62
R- GCTCAGTAACAGTCCGCCTAGAA
Table 2.
Effects of intoxication with MNPs and co-treatment with QUE on folliculogenesis.
Control QUE MNPs MNPs+QUE
Primordial follicle 7.3 ± 0.36a 7 ± 0.42a 6.3 ± 0.45a 6.7 ± 0.42a
Primary follicle 6.2 ± 0.37a 5.6 ± 0.33a 5.4 ± 0.27a 5.8 ± 0.39a
Secondary follicle 4.1 ± 0.4a 3.2 ± 0.36a 2.9 ± 0.31a 3.1 ± 0.34a
Graafian follicle 1.9 ± 0.23a 1.7 ± 0.21a 1.5± 0.17a 1.6 ± 0.2a

Each value represented the means ± SEM. Tukey's honestly significant difference (p ≤ 0.05) test was applied after a one-way analysis of variance (ANOVA). The differences between the groups within the same row were represented by means with different letters..

Table 3.
Protective benefits of QUE against hormonal alterations in female rats induced by MNPs.
Control QUE MNPs MNPs + QUE
FSH (mIU/ml) 4.93 ± 0.11a 4.6 ± 0.16a 2.66 ± 0.09b 4.09 ±. 012c
LH (mIU/ml) 3.94 ± 0.14a 3.91 ± 0.06a 2.41 ± 0.12b 3.83 ± 0.18a,c
E2 (Pg/ml) 49.6 ± 1.5a 50.03 ± 1.04a 25.09 ± 0.89b 32.77 ± 2.08c
PR (ng/ml) 38.28 ± 0.95a 38.13 ± 0.82a 22.47 ± 0.91b 29.40 ± 0.7c

Each value represented the means ± SEM. Tukey's honestly significant difference (p ≤ 0.05) test was applied after a one-way analysis of variance (ANOVA). The differences between the groups within the same row were represented by means with different letters.

Table 4.
Alleviation efficiency of QUE against MNPs-induced alterations in ovarian redox status of female rats.
Control QUE MNPs MNPs + QUE
MDA (nmol/mg) 1.74 ± 0.14a 1.64 ± 0.11a 2.95 ± 0.12b 2.08 ± 0.17a,c
SOD (U/g tissue) 312.1 ± 3.4a,c 326.3 ± 3.09a 209.5 ± 2.94b 300.6 ± 4.93c,d
GSH (μmol/g tissue) 626.8 ± 1.5a 631.6 ± 1.7b 439.1 ± 0.8c 519.9 ± 1.3d
TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
XML Download  XML Download
Full text via DOI  Full text via DOI
Download Citation  Download Citation
  Print
Share:      
METRICS
7
Crossref
0
Scopus
7,291
View
60
Download
Editorial Office
Division of Environmental Science and Ecological Engineering, Korea University
145 Anam-ro, Seongbuk-gu, Seoul 02841, Korea
E-mail: envitoxic@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © 2026 by The Korean Society of Environmental Health and Toxicology & Korea Society for Environmental Analysis.     Developed in M2PI